Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3208862
End position: 3208891
Length: 30

DNA sequence
>NC_014210, from 3208862 to 3208891 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GAACGGGGCCGGACCGGGCCGGACGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3207554-3208960	Sequence	Ndas_2692 - metallophosphoesterase (Protein is coded in complementary strand; from 3208960 to 3207554)