Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3198176
End position: 3198199
Length: 24

DNA sequence
>NC_014210, from 3198176 to 3198199 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGACGGCCACGGCGACGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3198174-3198584	Sequence	Ndas_2684 - hypothetical protein (Protein is coded in complementary strand; from 3198584 to 3198174)