Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3087801
End position: 3087845
Length: 45

DNA sequence
>NC_014210, from 3087801 to 3087845 (45 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GTCGGCGGCGACGGTGTCGGCGCCGGAGGTGTCGGCGCCGGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3087544-3088266	Sequence	Ndas_2592 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 3088266 to 3087544)