Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 3050310
End position: 3050333
Length: 24

DNA sequence
>NC_014210, from 3050310 to 3050333 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGCGGCGCGGCGCCGCGGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3049515-3050396	Sequence	Ndas_2558 - molybdate ABC transporter inner membrane subunit (Protein is coded in complementary strand; from 3050396 to 3049515)