Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 304132
End position: 304185
Length: 54

DNA sequence
>NC_014210, from 304132 to 304185 (54 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGTCGCGGCCCTGCCGTTCGTCGCGGCCCTGCCCTTCGCTGCGGCCCTCCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 301922-304441	Sequence	Ndas_0246 - 1,4-alpha-glucan branching protein (Protein is coded in complementary strand; from 304441 to 301922)