Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 300344
End position: 300367
Length: 24

DNA sequence
>NC_014210, from 300344 to 300367 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CACGGCCGCGGCCACGCCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 299364-300791	Sequence	Ndas_0244 - amino acid permease-associated protein (Protein is coded in complementary strand; from 300791 to 299364)