Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2980929
End position: 2980952
Length: 24

DNA sequence
>NC_014210, from 2980929 to 2980952 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGGACCGGGACGGGAACCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2978779-2980983	Sequence	Ndas_2513 - hydantoinase/oxoprolinase (Protein is coded in complementary strand; from 2980983 to 2978779)