Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2978029
End position: 2978052
Length: 24

DNA sequence
>NC_014210, from 2978029 to 2978052 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GTGGGCGTGGTCGAGGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2977691-2978782	Sequence	Ndas_2512 - hypothetical protein (Protein is coded in complementary strand; from 2978782 to 2977691)