Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2752502
End position: 2752525
Length: 24

DNA sequence
>NC_014210, from 2752502 to 2752525 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCGGGAGCGGGGGTGGGGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2751522-2752544	Sequence	Ndas_2303 - inner-membrane translocator (Protein is coded in complementary strand; from 2752544 to 2751522)