Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2718960
End position: 2718983
Length: 24

DNA sequence
>NC_014210, from 2718960 to 2718983 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGACCGCGACCGCGGCCGCGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2718830-2718991	Sequence	Ndas_2272 - hypothetical protein (Protein is coded in complementary strand; from 2718991 to 2718830)