Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2656156
End position: 2656180
Length: 25

DNA sequence
>NC_014210, from 2656156 to 2656180 (25 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGGCAGGGCGGGGCCGGTCAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2655191-2656753	Sequence	Ndas_2223 - CdaR family transcriptional regulator (Protein is coded in complementary strand; from 2656753 to 2655191)