Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2654916
End position: 2654960
Length: 45

DNA sequence
>NC_014210, from 2654916 to 2654960 (45 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGTCGACCAGGTCGGCGTCGCGCAGGTCCGCCTCGGTCAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2654370-2655101	Sequence	Ndas_2222 - pentapeptide repeat-containing protein (Protein is coded in complementary strand; from 2655101 to 2654370)