Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2636720
End position: 2636755
Length: 36

DNA sequence
>NC_014210, from 2636720 to 2636755 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GTTGGCGCCCAGGGTGGCGGCCAGGTCGTCGCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2636412-2637446	Sequence	Ndas_2206 - transporter permease (Protein is coded in complementary strand; from 2637446 to 2636412)