Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2330408
End position: 2330432
Length: 25

DNA sequence
>NC_014210, from 2330408 to 2330432 (25 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGCCGTGCCGGGTCGGCCCGGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2330176-2331294	Sequence	Ndas_1910 - ABC transporter (Protein is coded in complementary strand; from 2331294 to 2330176)