Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2303795
End position: 2303818
Length: 24

DNA sequence
>NC_014210, from 2303795 to 2303818 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCCGTGGCCGTGGCCGTGGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2302947-2303891	Sequence	Ndas_1888 - type 12 methyltransferase (Protein is coded in complementary strand; from 2303891 to 2302947)