Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2258849
End position: 2258872
Length: 24

DNA sequence
>NC_014210, from 2258849 to 2258872 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGACGACGACGGCGCCGACGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2258263-2259348	Sequence	Ndas_1849 - sodium/calcium exchanger membrane protein