Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 2041434
End position: 2041457
Length: 24

DNA sequence
>NC_014210, from 2041434 to 2041457 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGCCGCCGCCGTCGACGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2039937-2041826	Sequence	Ndas_1669 - peptidase S9 prolyl oligopeptidase active site domain-containing protein