Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1813919
End position: 1813963
Length: 45

DNA sequence
>NC_014210, from 1813919 to 1813963 (45 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGCGGCGACGACGGCCTCGGCGAAGACGGCGTCGGCGCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1813615-1814088	Sequence	Ndas_1480 - hypothetical protein (Protein is coded in complementary strand; from 1814088 to 1813615)