Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1808805
End position: 1808828
Length: 24

DNA sequence
>NC_014210, from 1808805 to 1808828 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 ACCGCGACCGCGCCCGCGACCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1808508-1809914	Sequence	Ndas_1476 - hypothetical protein (Protein is coded in complementary strand; from 1809914 to 1808508)