Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1784329
End position: 1784355
Length: 27

DNA sequence
>NC_014210, from 1784329 to 1784355 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGCCGTCGCCGCCGTCGGCGCGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1784031-1786592	Sequence	Ndas_1457 - AMP-dependent synthetase and ligase