Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1747445
End position: 1747471
Length: 27

DNA sequence
>NC_014210, from 1747445 to 1747471 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGCCGCCGTCTCCGCCGTCCCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1747381-1747638	Sequence	Ndas_1426 - hypothetical protein (Protein is coded in complementary strand; from 1747638 to 1747381)