Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1608190
End position: 1608234
Length: 45

DNA sequence
>NC_014210, from 1608190 to 1608234 (45 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GGGCCTGAGGGTACGGAGCCTGAGGATACGGAGCTTGCGGGTACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1607523-1608380	Sequence	Ndas_1300 - hypothetical protein (Protein is coded in complementary strand; from 1608380 to 1607523)