Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1480089
End position: 1480124
Length: 36

DNA sequence
>NC_014210, from 1480089 to 1480124 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCGTTCTCCTCCTCGGTGTCCTCCTCCTTCTTCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1478298-1483841	Sequence	Ndas_1213 - hypothetical protein (Protein is coded in complementary strand; from 1483841 to 1478298)