Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1465551
End position: 1465577
Length: 27

DNA sequence
>NC_014210, from 1465551 to 1465577 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGTCCTCGTCGTCCTCGTCGTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1464938-1467829	Sequence	Ndas_1205 - ATPase AAA (Protein is coded in complementary strand; from 1467829 to 1464938)