Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1461899
End position: 1461925
Length: 27

DNA sequence
>NC_014210, from 1461899 to 1461925 (27 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CATGCCGCCCATGCCTCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1461555-1464905	Sequence	Ndas_1204 - hypothetical protein (Protein is coded in complementary strand; from 1464905 to 1461555)