Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1245803
End position: 1245826
Length: 24

DNA sequence
>NC_014210, from 1245803 to 1245826 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGGCGGCGGTGACGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1245383-1245892	Sequence	Ndas_1018 - TspO and MBR like protein (Protein is coded in complementary strand; from 1245892 to 1245383)