Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1232664
End position: 1232723
Length: 60

DNA sequence
>NC_014210, from 1232664 to 1232723 (60 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TGCCGTCGTCGCCGCCCCCGTCGTCACCGCCGCCGTCATCGCCTCCGCCGTCGTCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1231574-1233196	Sequence	Ndas_1008 - pectate disaccharide-lyase (Protein is coded in complementary strand; from 1233196 to 1231574)