Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1219886
End position: 1219921
Length: 36

DNA sequence
>NC_014210, from 1219886 to 1219921 (36 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CCGGTGTCCGTGCCGGTCTCCGCGTCGGTGTCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1219295-1219954	Sequence	Ndas_0997 - hypothetical protein (Protein is coded in complementary strand; from 1219954 to 1219295)