Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 115323
End position: 115352
Length: 30

DNA sequence
>NC_014210, from 115323 to 115352 (30 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CGGATCCGCGCAGGTCCGCGCGGGTGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 113966-115399	Sequence	Ndas_0090 - magnesium protoporphyrin chelatase (Protein is coded in complementary strand; from 115399 to 113966)