Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1148844
End position: 1148871
Length: 28

DNA sequence
>NC_014210, from 1148844 to 1148871 (28 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 CTCCGCCCCCCGCCCTCCGTCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1148831-1150273	Sequence	Ndas_0934 - cell envelope-related transcriptional attenuator