Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1146315
End position: 1146338
Length: 24

DNA sequence
>NC_014210, from 1146315 to 1146338 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 GCGCGGGTGCGGGCGCAGGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1146289-1147713	Sequence	Ndas_0932 - glutamine synthetase (Protein is coded in complementary strand; from 1147713 to 1146289)