Sequence retrieval

Genome: Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
Start position: 1038917
End position: 1038940
Length: 24

DNA sequence
>NC_014210, from 1038917 to 1038940 (24 bp); Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111 TCCCGGTTCCGGTCCGGGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1037680-1038975	Sequence	Ndas_0845 - bile acid-inducible L-carnitine dehydratase protein F (Protein is coded in complementary strand; from 1038975 to 1037680)