Sequence retrieval

Genome: Mycoplasma crocodyli MP145
Start position: 929809
End position: 929835
Length: 27

DNA sequence
>NC_014014, from 929809 to 929835 (27 bp); Mycoplasma crocodyli MP145 CAATTTCTTTAATTTCTTCAATTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 928440-930449	Sequence	MCRO_0774 ftsH cell division protein FtsH (Protein is coded in complementary strand; from 930449 to 928440)