Sequence retrieval

Genome: Mycoplasma crocodyli MP145
Start position: 630982
End position: 631008
Length: 27

DNA sequence
>NC_014014, from 630982 to 631008 (27 bp); Mycoplasma crocodyli MP145 ACCAGTTACACCAGTGACCCCAGTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 630600-631814	Sequence	MCRO_0533 - putative extracellular nuclease, EndA/NucM family