Sequence retrieval

Genome: Mycoplasma crocodyli MP145
Start position: 571912
End position: 571938
Length: 27

DNA sequence
>NC_014014, from 571912 to 571938 (27 bp); Mycoplasma crocodyli MP145 TTATAATAATTAAAATAATTATCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 571771-573105	Sequence	MCRO_0481 - hypothetical protein (Protein is coded in complementary strand; from 573105 to 571771)