Sequence retrieval

Genome: Mycoplasma crocodyli MP145
Start position: 56194
End position: 56220
Length: 27

DNA sequence
>NC_014014, from 56194 to 56220 (27 bp); Mycoplasma crocodyli MP145 AGGTGTTTCAGGTGTTTCAGGTGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 54767-56338	Sequence	MCRO_0053 - putative lipoprotein (Protein is coded in complementary strand; from 56338 to 54767)