Sequence retrieval

Genome: Mycoplasma crocodyli MP145
Start position: 437720
End position: 437743
Length: 24

DNA sequence
>NC_014014, from 437720 to 437743 (24 bp); Mycoplasma crocodyli MP145 TTTTCAATTTCATTTTCTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 437696-438154	Sequence	MCRO_0374 - hypothetical protein (Protein is coded in complementary strand; from 438154 to 437696)