Sequence retrieval

Genome: Methanohalophilus mahii DSM 5219
Start position: 848110
End position: 848137
Length: 28

DNA sequence
>NC_014002, from 848110 to 848137 (28 bp); Methanohalophilus mahii DSM 5219 AAAAGTTAAAAGTTAAAAGTTAAAAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 848123-848962	Sequence	Mmah_0829 - beta-lactamase (Protein is coded in complementary strand; from 848962 to 848123)