Sequence retrieval

Genome: Methanohalophilus mahii DSM 5219
Start position: 136078
End position: 136107
Length: 30

DNA sequence
>NC_014002, from 136078 to 136107 (30 bp); Methanohalophilus mahii DSM 5219 AAATATTCAGAACTCTTCAGTAATTTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 132735-136460	Sequence	Mmah_0109 - peptidase S8 and S53 subtilisin kexin sedolisin