Sequence retrieval

Genome: Methanohalophilus mahii DSM 5219
Start position: 1231187
End position: 1231210
Length: 24

DNA sequence
>NC_014002, from 1231187 to 1231210 (24 bp); Methanohalophilus mahii DSM 5219 TGTTGTTGCTGTTGTTGTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1231175-1231606	Sequence	Mmah_1207 - prefoldin, subunit alpha (Protein is coded in complementary strand; from 1231606 to 1231175)