Sequence retrieval

Genome: Anabaena variabilis ATCC 29413
Start position: 2015
End position: 2050
Length: 36

DNA sequence
>NC_014000, from 2015 to 2050 (36 bp); Anabaena variabilis ATCC 29413 TCACCGTCGCCGTCACCGTCACCGTCACCGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1679-3643	Sequence	Ava_D0004 - hypothetical protein (Protein is coded in complementary strand; from 3643 to 1679)