Sequence retrieval

Genome: Anabaena variabilis ATCC 29413
Start position: 1186
End position: 1209
Length: 24

DNA sequence
>NC_014000, from 1186 to 1209 (24 bp); Anabaena variabilis ATCC 29413 ACCACCACCACCACCTCCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 539-1360	Sequence	Ava_D0002 - PE-PGRS family protein (Protein is coded in complementary strand; from 1360 to 539)