Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 857765
End position: 857800
Length: 36

DNA sequence
>NC_013446, from 857765 to 857800 (36 bp); Comamonas testosteroni CNB-2 TGGCGGCTTTCTTGGCTGCGTTCTCGGCGGCTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 856153-857895	Sequence	CtCNB1_0762 - type IV-A pilus assembly ATPase PilB (Protein is coded in complementary strand; from 857895 to 856153)