Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 553108
End position: 553131
Length: 24

DNA sequence
>NC_013446, from 553108 to 553131 (24 bp); Comamonas testosteroni CNB-2 GCAGCAGCACCAGCAGCAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 552057-553790	Sequence	CtCNB1_0502 - Na+/H+ antiporter (Protein is coded in complementary strand; from 553790 to 552057)