Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 5180413
End position: 5180436
Length: 24

DNA sequence
>NC_013446, from 5180413 to 5180436 (24 bp); Comamonas testosteroni CNB-2 ATGAGCATGGGCTTGAGCATGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5179813-5180640	Sequence	CtCNB1_4629 - hypothetical protein (Protein is coded in complementary strand; from 5180640 to 5179813)