Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 510354
End position: 510377
Length: 24

DNA sequence
>NC_013446, from 510354 to 510377 (24 bp); Comamonas testosteroni CNB-2 GACGACGAGGACGCCGACGAAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 509890-510444	Sequence	CtCNB1_0464 - flagellar basal body-associated protein FliL