Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 4936370
End position: 4936393
Length: 24

DNA sequence
>NC_013446, from 4936370 to 4936393 (24 bp); Comamonas testosteroni CNB-2 TGCGGCTGCCGCAGCGGCTGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4935627-4937903	Sequence	CtCNB1_4394 - outer membrane efflux protein (Protein is coded in complementary strand; from 4937903 to 4935627)