Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 4595069
End position: 4595113
Length: 45

DNA sequence
>NC_013446, from 4595069 to 4595113 (45 bp); Comamonas testosteroni CNB-2 GCGGCCGCCACGGGAGCAGCGGCAACGGGAGCTGCCGCCAAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4594817-4595278	Sequence	CtCNB1_4089 - acetyl-CoA carboxylase, biotin carboxyl carrier (Protein is coded in complementary strand; from 4595278 to 4594817)