Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 4481473
End position: 4481496
Length: 24

DNA sequence
>NC_013446, from 4481473 to 4481496 (24 bp); Comamonas testosteroni CNB-2 CGCCCACGGCCACGGCCAGGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4480116-4481600	Sequence	CtCNB1_3995 - low-affinity cationic amino acid transporter (Protein is coded in complementary strand; from 4481600 to 4480116)