Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 4374000
End position: 4374024
Length: 25

DNA sequence
>NC_013446, from 4374000 to 4374024 (25 bp); Comamonas testosteroni CNB-2 GCAGCTCAGCGCATCGCCGCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4373770-4374480	Sequence	CtCNB1_3900 - methyltransferase (Protein is coded in complementary strand; from 4374480 to 4373770)